Heptapeptide raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-06-20 and is reviewed periodically as new material appears.
Melanotan II is a synthetic cyclic heptapeptide analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its structure substitutes a lactam bridge between side chains to increase stability relative to the native hormone. The compound is also known by the shorthand MT-II and by several non-proprietary synonyms used in research catalogues. It is not an approved therapeutic product in any major jurisdiction; material sold under this name is typically offered as a laboratory reagent rather than as a medicine.
Activity is attributed to agonism at melanocortin receptors, particularly MC1R and MC4R. Activation of MC1R on melanocytes increases melanin synthesis, which underlies the reported tanning effect. MC4R engagement in the central nervous system is linked to appetite suppression and to effects on sexual arousal reported in early clinical studies. Those studies were small and were not designed to establish efficacy or long-term safety. Receptor selectivity among the melanocortin subtypes is not absolute, which complicates attribution of any effect to a single pathway.
Regulatory treatment varies between countries. Several national medicines agencies have classified the peptide as unapproved, and customs authorities in some jurisdictions seize shipments on that basis. A few jurisdictions channel supply through prescription-only frameworks that do not list the substance by name. Because the material circulates mainly through online vendors, composition and purity are rarely verified before sale. Surveys of unapproved peptide products have reported labels that did not match measured content in a substantial fraction of samples.
Regulatory treatment of this peptide varies by country. It holds no marketing authorization as a medicine in the United States, the European Union, or most other jurisdictions. Some countries classify products containing it as prescription-only or unlicensed medicines, which restricts lawful supply. Authorities have issued public notices warning that unregulated products may contain undeclared or incorrect ingredients. The molecule also appears on prohibited lists for competitive sport. These measures address supply oversight rather than any approved therapeutic role.
Published research on the compound remains limited. Much of the human data comes from small, early-stage studies rather than large controlled trials, and several questions about effects and variability between individuals remain open. Investigators have examined receptor activity, pigment pathways, and related physiological responses in laboratory and animal models. Findings from those models do not automatically translate to human outcomes. Reviews frequently note the scarcity of rigorous clinical evidence and call for better-characterized study material.
Because the substance circulates mainly through informal markets, verification is a recurring theme in technical discussion. Independent analyses have found that labeled content and actual content can diverge, and that purity varies between samples. Analytical laboratories use reversed-phase chromatography to separate components and mass spectrometry to confirm identity. Isotope-labeled internal standards improve quantification in complex matrices. Such methods describe what a sample contains but say nothing about its sterility, lawful status, or suitability for any use. Open questions remain about how consistently testing is applied across the supply chain.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic cyclic heptapeptide | Analogue of alpha-melanocyte-stimulating hormone |
| Common synonyms | MT-II; melanotan 2 | No internationally accepted non-proprietary name |
| Typical presentation | Lyophilised powder in a sealed vial | Often supplied alongside a separate diluent |
| Regulatory status | Unapproved therapeutic substance | Customs seizure reported in several jurisdictions |
| Reported route in use | Subcutaneous injection | Self-administered outside clinical settings |
Melanotan-2, also written Melanotan II, is a synthetic cyclic heptapeptide designed as an analogue of alpha-melanocyte-stimulating hormone. Its sequence is Ac-Nle-cyclo[Asp-His-D-Phe-Arg-Trp-Lys]-NH2, and the lactam bridge between the aspartate and lysine side chains constrains the peptide into a ring. This structural change increases receptor affinity and metabolic stability relative to the native hormone. The compound was created in the 1980s as a research tool for studying pigmentation biology.
Melanocytes are the pigment-producing cells of the skin, and they carry melanocortin-1 receptors on their surface. When the receptor is activated, cyclic adenosine monophosphate rises inside the cell and raises the activity of enzymes such as tyrosinase, which increases melanin output. Melanotan-2 binds melanocortin-1 receptors in vitro and in animal models, and this binding is generally described as the basis for the tanning effect. Other receptors account for different effects: melanocortin-4 receptors contribute to appetite and erectile signalling, while melanocortin-3 and melanocortin-5 receptors contribute to energy balance and exocrine function.
Quality assessment of research-grade peptide rests mainly on reversed-phase high-performance liquid chromatography for purity and on mass spectrometry for identity confirmation. A single main peak above a stated threshold, commonly ninety-eight percent by peak area, is the usual release criterion applied by suppliers. Independent analyses commissioned by laboratories and consumer organisations have repeatedly reported discrepancies between label claims and measured content, including truncated sequences, residual trifluoroacetate, and lower-than-declared peptide mass. Those findings do not establish that every supplier is unreliable, but they indicate that purity figures printed on a vial are claims requiring verification rather than settled facts.
Regulatory treatment varies by jurisdiction and has changed over time. In several countries the peptide is handled as an unapproved prescription medicine, and import or sale for human use is restricted, while elsewhere it falls under poisons or controlled-substance schedules. Enforcement activity against online vendors has been reported in Australia, New Zealand, the United Kingdom and the United States. Scholarly writing discusses melanotan-2 chiefly as an experimental tool and as a case study in unregulated peptide supply, and its precise legal position in any given country should be checked against current national schedules.
Cecropins are antimicrobial peptides. They were first isolated from the hemolymph of Hyalophora cecropia, whence the term cecropin was derived. Cecropins lyse bacterial cell membranes; they also inhibit proline uptake and cause leaky membranes. Cecropins constitute a main part of the innate immune system of insects. Cecropins are small proteins anywhere from 31 to 37 amino acids long and are active against both gram-positive and gram-negative bacteria. Cecropins isolated from insects other than Hyalophora cecropia (Cecropia moth) have been given various names, such as bactericidin, lepidopterin, and sarcotoxin. All of these peptides are structurally related.
Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known by the abbreviations RuBisCo, rubisco, RuBPCase, or RuBPco, is an enzyme (EC 4.1.1.39) involved in the light-independent (or "dark") part of photosynthesis, including the carbon fixation by which atmospheric carbon dioxide is converted by plants and other photosynthetic organisms to energy-rich molecules such as glucose. It emerged approximately four billion years ago in primordial metabolism prior to the presence of oxygen on Earth. It is the most abundant enzyme on Earth. In chemical terms, it catalyzes the carboxylation of ribulose-1,5-bisphosphate (also known as RuBP).
The α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA receptor, AMPAR, or quisqualate receptor) is a nonselective ionotropic glutamate receptor (iGluR) that mediates fast excitatory neurotransmission in the central nervous system (CNS).
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
== Alternative terms == Ultra-high-definition television is also known as Ultra HD, UHD, UHDTV, and 4K. In Japan, 8K UHDTV will be known as Super Hi-Vision since Hi-Vision was the term used in Japan for HDTV. In the consumer electronics market companies had previously only used the term 4K at the 2012 CES but that had changed to "Ultra HD" during CES 2013. "Ultra HD" was selected by the Consumer Electronics Association after extensive consumer research, as the term has also been established with the introduction of "Ultra HD Blu-ray".
Hydrophobins have been found to be structurally and functionally similar to cerato-platanins, another group of small cysteine-rich proteins, which also contain a high percentage of hydrophobic amino acids, and are also associated with hyphal growth. This family of proteins includes the rodlet proteins of Neurospora crassa (gene eas) and Emericella nidulans (gene rodA), these proteins are the main component of the hydrophobic sheath covering the surface of many fungal spores. Genomic sequencing of two fungi from dry or salty environments (Wallemia sebi and W. ichthyophaga) revealed that these species contain predicted hydrophobins with unusually high proportion of acidic amino acids and therefore with potentially novel characteristics. High proportion of acidic amino acids is thought to be an adaptation of proteins to high concentrations of salt.
Sources: en.wikipedia.org
No. No major regulatory agency has granted a marketing authorisation for melanotan II as a medicine. Products sold under this name are generally presented as laboratory reagents and are not subject to the batch-release testing applied to approved drugs.
It was developed in the 1980s by researchers investigating analogues of alpha-melanocyte-stimulating hormone for pigmentation and related endpoints. Early work included small human studies during the 1990s. Development did not progress to licensing, and the compound remained a research and grey-market item.
Peptides are prone to truncation, oxidation and aggregation during synthesis and handling. Without independent testing, a buyer cannot confirm the identity or the content of a vial. Analytical surveys of unapproved peptide products have repeatedly found discrepancies between label claims and measured composition.
Only a small number of early-stage human studies have been reported, and most were limited in size and duration. No large late-stage program has established a general efficacy or safety profile. The evidence base is therefore thin compared with approved medicines.